View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2104-Insertion-4 (Length: 317)
Name: NF2104-Insertion-4
Description: NF2104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2104-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 9 - 173
Target Start/End: Original strand, 31121207 - 31121372
Alignment:
| Q |
9 |
aatgatgctgatgttaattgtactttattaattttgcagaccaagaaaaataaggatgatggtgatgattcgaatggtagcgatagtggcagtgcttcaa |
108 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31121207 |
aatgatgctgaagctaattgtactttgttaattttgcagaccaagaaaaataaggatgatgatgatgattcgaatggtagcgatagtggcagtgcttcaa |
31121306 |
T |
|
| Q |
109 |
gagggaactggtggaaaggtcagaaagttctc-ttggtttgaatgtccattatcaaaagcaataac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
31121307 |
gagggaactggtggaaaggtcagaaagttctctttggtttgaatgtccattagcaaaagcaataac |
31121372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 242 - 317
Target Start/End: Original strand, 31121437 - 31121513
Alignment:
| Q |
242 |
cttttacttattattctc-gtttataatttgtgcaggttccctttattattaacatcataatcctgccacagtatgc |
317 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
31121437 |
cttttacttattatttaccgtttataatttgtgcaggttccctttattactaacatcataagtctgccacagtatgc |
31121513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University