View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2104-Insertion-7 (Length: 200)
Name: NF2104-Insertion-7
Description: NF2104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2104-Insertion-7 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 200
Target Start/End: Complemental strand, 35205827 - 35205633
Alignment:
| Q |
6 |
cagtttctggtttagttgaattgataaagaaaggaacaattcgaggaaaaaagaacgcggtgcttgcaattttcgggttgttattgcttcataagaatca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205827 |
cagtttctggtttagttgaattgataaagaaaggaacaattcgaggaaaaaagaacgcggtgcttgcaattttcgggttgttattgcttcataagaatca |
35205728 |
T |
 |
| Q |
106 |
ttctaaggtgcttaactctggtgttgttccggctattgttaaagttttaggttcttcggataaaggttatgttgttaatgattgtttagcggttt |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205727 |
ttctaaggtacttaactctggtgttgttccggctattgttaaagttttaggttcttcggataaaggttatgttgttaatgattgtttagcggttt |
35205633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University