View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2104-Insertion-8 (Length: 168)
Name: NF2104-Insertion-8
Description: NF2104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2104-Insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 8 - 163
Target Start/End: Original strand, 193107 - 193263
Alignment:
| Q |
8 |
gaagtgagatcactcactccttactcatatactctttgataatctttaactcgttgcagtaatgatgaaaatgatgagcccc-tctttcactagctaaac |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
193107 |
gaagcgagatcactcactccttactcatgtactctttgataatctttaacttgttgcagtaatgatgaaaataatgagccccctctttcactagctaaac |
193206 |
T |
|
| Q |
107 |
aacatgtaaagagttggtgcaacaaactataattctaatgcttacttcccaacaaag |
163 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
193207 |
aacatgtaaagagtcggtgcaacaaactataattctaatgtttacttcccaacaaag |
193263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 16 - 163
Target Start/End: Original strand, 189179 - 189326
Alignment:
| Q |
16 |
atcactcactccttactcatatactctttgataatctttaactcgttgcagtaatgatgaaaatgatgag-cccctctttcactagctaaacaacatgta |
114 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
189179 |
atcactcactccctactcgtgtactctttgataatctttaactcgttacactaatgatgaaaatgatgagtcccctctttcgctagctaaacaacatgta |
189278 |
T |
|
| Q |
115 |
aagagttggtgcaacaaactataattctaatgcttacttcccaacaaag |
163 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
189279 |
aagagtcggtgcaacaaacta-aattctaatacttactttacaacaaag |
189326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University