View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21040_low_14 (Length: 283)
Name: NF21040_low_14
Description: NF21040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21040_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 14 - 264
Target Start/End: Original strand, 15420291 - 15420539
Alignment:
| Q |
14 |
atcattatgaaatctcagaaatgatgcatgtctacaaggatctaccattatccaagacaaataattttattttgaatgcaaaccatagacatataacctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420291 |
atcattatgaaatctcagaaatgatgcatgtctacaaggatctaccattatccaagacaaataattttattttgaatgcaaaccatagacatataacctt |
15420390 |
T |
 |
| Q |
114 |
tatacatattgcaacaaaaactatataccataattaagaaaggtacctataaggactgagtatagcgcctggaatttgaacttttctagttaatggtttc |
213 |
Q |
| |
|
|| | ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420391 |
taaa--tattgtaacaaaaactatatagcataattaagaaaggtacctataaggactgagtatagcgcctggaatttgaacttttctagttaatggtttc |
15420488 |
T |
 |
| Q |
214 |
caaggtttgtccataaaatctgacatgctcatttcacattcatctccaaaa |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15420489 |
caaggtttgtccataaaatctgacatgctcatttcacattcatctccaaaa |
15420539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University