View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21040_low_18 (Length: 268)
Name: NF21040_low_18
Description: NF21040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21040_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 15047158 - 15047409
Alignment:
| Q |
1 |
tgagtgtttatcaatcttttttctttattgatagatccttgcgaaacatatttaaaaatttcatcaagaatgcttgcaacacttttgttttgtaatgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15047158 |
tgagtgtttatcaatcttttttctttattaatagatccttgcgaaacatatttaaaaatttcatcaagaatgcttgcaacacttttgttttgtaatgttc |
15047257 |
T |
 |
| Q |
101 |
atctgaacacttactattttattgaatgatctcaatttcgttctatacttaaaaatatatttaacataaaatgatagaacaggcataaattcgtgaattt |
200 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
15047258 |
acctgaacatttactattttattgaatgatctcaatttcgttctatacttaaaaatagatttaacataagatgataaaacagacataaattcgtgaattt |
15047357 |
T |
 |
| Q |
201 |
cactcaataagataatcagcaatgataaggggcgttccaagcagttctcttt |
252 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15047358 |
cactcaataagataatcagcagtgataaggggcgttccaagcagttctcttt |
15047409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University