View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21040_low_23 (Length: 248)
Name: NF21040_low_23
Description: NF21040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21040_low_23 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 248
Target Start/End: Complemental strand, 21887851 - 21887619
Alignment:
| Q |
16 |
caggatcaccacccgtggtaatagcgcgcggtggattttcaggaatatttccagattcaagtttagcttcctataacttggcactaaaagctagttcccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21887851 |
caggatcaccacccgtggtaatagcgcgcggtggattttcaggaatatttccagattcaagtttagcttcctataacttggcactaaaagctagttcccc |
21887752 |
T |
 |
| Q |
116 |
aaatatcactctatggtgtgacttgcaacttacaaaggatggagttgggatttgttttccagacatcaagcttgacaatgccactgacatttccgttgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
21887751 |
aaatatcactctatggtgtgacttgcaacttacaaaggatggagttgggatttgttttccagacgtcaaacttgacaatgccactgacatttccgttgtt |
21887652 |
T |
 |
| Q |
216 |
taccctggcaaagcgaaggattattcagttaac |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21887651 |
taccctggcaaagcgaaggattattcagttaac |
21887619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University