View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_high_18 (Length: 378)
Name: NF21042_high_18
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 349; Significance: 0; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 33092966 - 33092606
Alignment:
| Q |
1 |
tcagctatgaaggttatatcagtgtgattgagaggagaaccgagattagaacaagtgagagaggtcaaggataattgagtctttttgacaagtttttcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092966 |
tcagctatgaaggttatatcagtgtgattgagaggagaaccgagattagaacaagtgagagaggtcaaggataattgagtctttttgacaagtttttcca |
33092867 |
T |
 |
| Q |
101 |
accctaaagcagggaacgtggggtggttggagaggttgagggaagtcaggtaggagagggaacaagaacaggagtcacgacagagaagcgagttgaggtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33092866 |
accctaaagcagggaacgtggggtggttggagaggttgagggaagtcaggtaggagagggaacaagaacaggagtcacgacagagaagcgagttgaggtc |
33092767 |
T |
 |
| Q |
201 |
gtcgccgcggaagcgagagaagtcgagggaggttaggtatgggaatctgtggaaaatgcgagtgaggcatactgatggattcaagattgttagagaatat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33092766 |
gtcgccgcggaagcgagagaagtcgagggaggttaggtatgggaatctgtggaaaatgcgagtgaggcatactgatggattcaagattgtgagagaatat |
33092667 |
T |
 |
| Q |
301 |
actaaacaaccgctggtggatagaaccttttggagacaaaggatagagtctgccttatata |
361 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33092666 |
acttaacaaccgctggtggatagaaccttttggagacaaaggatacagtctgccttatata |
33092606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 99 - 146
Target Start/End: Complemental strand, 33713805 - 33713758
Alignment:
| Q |
99 |
caaccctaaagcagggaacgtggggtggttggagaggttgagggaagt |
146 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33713805 |
caaccctaactcagggaaggtggggtggttggagaggttgagggaagt |
33713758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 49 - 140
Target Start/End: Original strand, 33397587 - 33397678
Alignment:
| Q |
49 |
gaacaagtgagagaggtcaaggataattgagtctttttgacaagtttttccaaccctaaagcagggaacgtggggtggttggagaggttgag |
140 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||| ||||||| || ||| ||| ||||| | ||||| ||||||||||| ||||||||||| |
|
|
| T |
33397587 |
gaacaagtgagagaggtcaaggttgatttagtgtttttgagaatagtttgcaatcctaacgtggggaaagtggggtggtttgagaggttgag |
33397678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 99 - 146
Target Start/End: Complemental strand, 33707971 - 33707924
Alignment:
| Q |
99 |
caaccctaaagcagggaacgtggggtggttggagaggttgagggaagt |
146 |
Q |
| |
|
||||||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33707971 |
caaccctaactcggggaaggtggggtggttggagaggttgagggaagt |
33707924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 78 - 143
Target Start/End: Complemental strand, 27004742 - 27004677
Alignment:
| Q |
78 |
agtctttttgacaagtttttccaaccctaaagcagggaacgtggggtggttggagaggttgaggga |
143 |
Q |
| |
|
||||||||||| ||| ||| ||||||||| | ||||| |||| ||||||||||||||||||||| |
|
|
| T |
27004742 |
agtctttttgagaagagtttgcaaccctaagacggggaaggtggtgtggttggagaggttgaggga |
27004677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University