View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_high_34 (Length: 284)
Name: NF21042_high_34
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_high_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 14 - 284
Target Start/End: Original strand, 1608422 - 1608692
Alignment:
| Q |
14 |
agataaactgtcaatgcaaagaacaggagaagtttaacatttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactcca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608422 |
agataaactgtcaatgcaaagaacaggagaagtttaacttttttgcaacaaaatatcaaattttgcacagatatattctttctgacttcatcaaactcca |
1608521 |
T |
|
| Q |
114 |
atcttgagtagtaaagaaaatacatttgtgacaaacatacatgtctaaatcaactaaaccacataagccctttaccctagaatttaatttgaatcatcgc |
213 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1608522 |
attttgagtagtaaagaaaatacatttgtgacaaacatacatgcctaaatcaactaaaccacataagccctttaccctagaatttaatttgaatcatcac |
1608621 |
T |
|
| Q |
214 |
aaactatcataagcaaaatgagctaaaatgttgaacctttatgcattggaagccggtaaccatagcattgt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608622 |
aaactatcataagcaaaatgagctaaaatgttgaacctttatgcattggaagccggtaaccatagcattgt |
1608692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University