View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_high_46 (Length: 242)
Name: NF21042_high_46
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_high_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 5 - 219
Target Start/End: Complemental strand, 21483248 - 21483034
Alignment:
| Q |
5 |
taaccatcatcagaatattcaaggttctgatccacttgcgagattaggtagtggtgataattgcaccaatgttgctgctggtggttctcatgcaaatcca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483248 |
taaccatcatcagaatattcaaggttctgatccacttgcgagattaggtagtggtgatagttgcaccaatgttgctgctggtggttctcatgcaaatcca |
21483149 |
T |
|
| Q |
105 |
gcgaactggatgtattggcagactatgaccggtgggacagcagcttccttggcacctgttgttccggctgagccgacgcagcctccagtggaccgtgacc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483148 |
gcgaactggatgtattggcagactatgaccggtgggacagcagcctccttggcacctgttgttccggctgagccgacgcagcctccagtggaccgtgacc |
21483049 |
T |
|
| Q |
205 |
gccccaccatgcaga |
219 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21483048 |
gccccaccatgcaga |
21483034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University