View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21042_high_55 (Length: 208)

Name: NF21042_high_55
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21042_high_55
NF21042_high_55
[»] chr3 (1 HSPs)
chr3 (18-130)||(22949002-22949113)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 130
Target Start/End: Original strand, 22949002 - 22949113
Alignment:
18 aaatactcctgtgtgttttgttatatgttaactttgcaatacttttttcaggggttgaaataatatatgtattttattataagtcacttttcaataacaa 117  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
22949002 aaatactcctgtgtgttttgttatatgtta-ctttgcaatacttttttcaggggttgaaataatatgtgtattttattataagtcacttttcaataacaa 22949100  T
118 tgaaactttaatg 130  Q
    |||||||||||||    
22949101 tgaaactttaatg 22949113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University