View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_high_57 (Length: 202)
Name: NF21042_high_57
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_high_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 668665 - 668482
Alignment:
| Q |
1 |
ctctgaacattgttgaatagttgaatagtttcagattctctaacacattctcggacgagttcaacttatatactccgaacattgttgaatagtttcagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||| ||||||| |
|
|
| T |
668665 |
ctctgaacattgttgaatagttgaatagtttcagattctctaacacattctcggacgagttcaagttatatactccgaacatcgtggaataggttcagat |
668566 |
T |
|
| Q |
101 |
ttctataattcaaaccagtttagagtttggatgatgacttgctcaacacgactaactcgccgaaatggtagcaaacgagagtat |
184 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
668565 |
ggctataattcaaaccagtttagagtggggatgatgacttgctcaacacgactaactcgccgaaatggtagcaaacgagagtat |
668482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University