View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_23 (Length: 363)
Name: NF21042_low_23
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 17 - 345
Target Start/End: Original strand, 6638202 - 6638532
Alignment:
| Q |
17 |
atgaaattaattgaagcatgattgcaacacaaagattttttgttacggttagttggcttttcccatttctgaaataccattcgttgatctagcggccata |
116 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6638202 |
atgaaattaaacgaagtatgattgcaacacaaagattttttgttacggttagttggcttttcccatttctgaaataccattcgttgatctagcggccata |
6638301 |
T |
|
| Q |
117 |
tcctttattttattctgaagtcattctcttctgccatacaccatgccaccttatcttctctttctctctatactctccatctccaaccaagtgggcatat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6638302 |
tcctttattttattctgaagtcattctcttctgccatacaccatgccaccttatcttctctttctctctctactctccatctccaaccaagtgggcatat |
6638401 |
T |
|
| Q |
217 |
actattatccattattagatctttttacttgtgcccatcnnnnnnnct--ttcatttattcaacaaccttttcctcctcaaaattatactacaaaatttt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6638402 |
actattatccattattagatctttttacttgtgcccatcttttttttttcttcatttattcaacaaccttttcctcctcaaaattatactacaaaatttt |
6638501 |
T |
|
| Q |
315 |
gatagtttggtcctcgaatataggaaatact |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6638502 |
gatagtttggtcctcgaatataggaaatact |
6638532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University