View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_28 (Length: 317)
Name: NF21042_low_28
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_28 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 147 - 317
Target Start/End: Complemental strand, 44548406 - 44548236
Alignment:
| Q |
147 |
ataagaaagtaaggagaaaagcaagccgagattccaaaagagaggattgatatgttgtcattgaatgcctcatcctactatgtgccaagcttccttaaac |
246 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44548406 |
ataagaaagtaatgagaaaagcaagccgagattccaaaagagaggattgatatgttgtcattgaatgcctcatcctactatgtgccaaccttccttaaac |
44548307 |
T |
 |
| Q |
247 |
accctcattgagtatatcttgtgttagccttcttatacctctttccccttccaagctcttgaggctgagtt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44548306 |
accctcattgagtatatcttgtgttagccttcttatacctctttccccttccaagctcttgaggctgagtt |
44548236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 44548455 - 44548405
Alignment:
| Q |
17 |
aatttatagttgaatctcaacaattgtgataatactcttctctaattatat |
67 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44548455 |
aatttatagttgaacctcaacaattgtgataatactcttttctaattatat |
44548405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University