View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_33 (Length: 292)
Name: NF21042_low_33
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 276
Target Start/End: Complemental strand, 45465885 - 45465628
Alignment:
| Q |
17 |
aagaacacaactgaatttattagtagtagtattatgtaatattaaaagttaagtcatgtcctcctgaatagtcggagaaacnnnnnnnttgagctagagc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
45465885 |
aagaacacaactgaatttattagtagtagtattatgtaatattaaaagttaagtcatgtcctcctgaatagtc--agaaacaaaaaaattgagctagagc |
45465788 |
T |
|
| Q |
117 |
aggcatacataaggatattcataatgctgaattttattgacttgaagaagctagtaactagagtacattggcatgtcaaaaagccctgcaaatgtaacca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45465787 |
aggcatacataaggatattcataatgctgaattttattgacttgaagaagctagtaactagagtacattggcatgtcaaaaagccctgcaaatgtaacca |
45465688 |
T |
|
| Q |
217 |
ttaaaaccaaaattgcaggaccgtcaacatacagcaaaaacatcaaaagctgctcgaact |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45465687 |
ctaaaaccaaaattgcaggaccgtcaacatacagcaaaaacatcaaaagctgctcgaact |
45465628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University