View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21042_low_39 (Length: 270)

Name: NF21042_low_39
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21042_low_39
NF21042_low_39
[»] chr4 (2 HSPs)
chr4 (73-133)||(19055561-19055621)
chr4 (182-252)||(19055702-19055770)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 73 - 133
Target Start/End: Original strand, 19055561 - 19055621
Alignment:
73 gaagacacgacgacgagttgcaacaagtatttcttttacttgttgactactgtaggtacga 133  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
19055561 gaagacgcgacgacgagttgcaacaagtatttcttttacttgttgactacggtaggtacga 19055621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 252
Target Start/End: Original strand, 19055702 - 19055770
Alignment:
182 ttatatagtggtccacatattacctttggggtacnnnnnnnncttttctttcattcaccatatagtaaatt 252  Q
    |||||||||||||| ||||||||||||||| |||        |||||||||||||||||||||||||||||    
19055702 ttatatagtggtccgcatattacctttggg-tactattttt-cttttctttcattcaccatatagtaaatt 19055770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University