View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_39 (Length: 270)
Name: NF21042_low_39
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 73 - 133
Target Start/End: Original strand, 19055561 - 19055621
Alignment:
| Q |
73 |
gaagacacgacgacgagttgcaacaagtatttcttttacttgttgactactgtaggtacga |
133 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19055561 |
gaagacgcgacgacgagttgcaacaagtatttcttttacttgttgactacggtaggtacga |
19055621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 182 - 252
Target Start/End: Original strand, 19055702 - 19055770
Alignment:
| Q |
182 |
ttatatagtggtccacatattacctttggggtacnnnnnnnncttttctttcattcaccatatagtaaatt |
252 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
19055702 |
ttatatagtggtccgcatattacctttggg-tactattttt-cttttctttcattcaccatatagtaaatt |
19055770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University