View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_41 (Length: 256)
Name: NF21042_low_41
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 78 - 199
Target Start/End: Complemental strand, 19055494 - 19055373
Alignment:
| Q |
78 |
gttcaatgctttgttgaaatttcctctcaaatctttaattactactgtgtatccatctaatttcgtaagagtgactcatgtttcaacctccaacttcaca |
177 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
19055494 |
gttcaatgctttgttggaattttctctcaaatctttaattactactgtgtttccgtctaattttgtaagagtgactcatgtttcaacctccaacttcaca |
19055395 |
T |
|
| Q |
178 |
ctatcacatgttatatcatgct |
199 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
19055394 |
ctatcacatgttacatcatgct |
19055373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 201 - 235
Target Start/End: Complemental strand, 19055355 - 19055321
Alignment:
| Q |
201 |
tccatggaatcaagaatttaattggtgatatatct |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19055355 |
tccatggaatcaagaatttaattggtgatatatct |
19055321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University