View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_50 (Length: 233)
Name: NF21042_low_50
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 47803434 - 47803640
Alignment:
| Q |
14 |
aaaactcattttacgtcacttagctcaccgcccgagctacctacataggacactagtatttacatattgattttgaaacatgtacttttcagtaatttca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803434 |
aaaactcattttacgtcacttagctcaccgcccgagctacctacataggacactagtatttacatattgattttgaaacatgtacttttcagtaatttca |
47803533 |
T |
|
| Q |
114 |
tctcataaccgtgttcatgtaaatatgcaattttatcggaatattttggattctagatggtgaaaggttagactatttttaaaacaaaataagtgtttgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47803534 |
tctcataaccgtgttcatgtaaatatgcaattttatctgaatattttggattctagatggtgaaaggttagactatttttaaaacaaaagaagtgtttgt |
47803633 |
T |
|
| Q |
214 |
tcatatc |
220 |
Q |
| |
|
||||||| |
|
|
| T |
47803634 |
tcatatc |
47803640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 79 - 150
Target Start/End: Original strand, 47806322 - 47806393
Alignment:
| Q |
79 |
attgattttgaaacatgtacttttcagtaatttcatctcataaccgtgttcatgtaaatatgcaattttatc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| | || | || ||||| | ||||||||||||||| |
|
|
| T |
47806322 |
attgattttgaaacatgtacttttcagtaattttatcttaaaatcatgctcatgcagatatgcaattttatc |
47806393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University