View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21042_low_55 (Length: 208)
Name: NF21042_low_55
Description: NF21042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21042_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 18 - 130
Target Start/End: Original strand, 22949002 - 22949113
Alignment:
| Q |
18 |
aaatactcctgtgtgttttgttatatgttaactttgcaatacttttttcaggggttgaaataatatatgtattttattataagtcacttttcaataacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22949002 |
aaatactcctgtgtgttttgttatatgtta-ctttgcaatacttttttcaggggttgaaataatatgtgtattttattataagtcacttttcaataacaa |
22949100 |
T |
 |
| Q |
118 |
tgaaactttaatg |
130 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22949101 |
tgaaactttaatg |
22949113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University