View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_high_28 (Length: 331)
Name: NF21043_high_28
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 39 - 324
Target Start/End: Complemental strand, 32798864 - 32798577
Alignment:
| Q |
39 |
tcataataataccatctacaggaaatggcccc--aacttgtggtgaccctaccatatcgtccttggttttgtagctaaagctatatttttgaagatgaaa |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798864 |
tcataataataccatctacaggaaatggccccccaacttgtggtgaccctaccatatcgtccttggttttgtagctaaagctatatttttgaagatgaaa |
32798765 |
T |
 |
| Q |
137 |
agtaaaatgtggatacaacgtgggtaaaagcttagactgagacaacaacctcatccacatgtgatgccctaatttaacttttcaattcatgtctttgacc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798764 |
agtaaaatgtggatacaacgtgggtaaaagcttagactgagacaacaacctcatccacatgtgatgccctaatttaacttttcaattcatgtctttgacc |
32798665 |
T |
 |
| Q |
237 |
ttacacatggctatggaagcttagaaagcacacttttctcaagataaagtgtcacgagtatccattaatcttccaagcatagattcat |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32798664 |
ttacacatggctatggaagcttagaaagcacacttttctcaagataaagtgtcacgagtatccattaatcttccaagcatagattcat |
32798577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University