View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_high_44 (Length: 245)
Name: NF21043_high_44
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 47376943 - 47377133
Alignment:
| Q |
14 |
aggtagacaatccatattcatcccaatgccagaaacatacagtcagtgtaaagctataacaaattcaaattcaatcttgggtgaggatgaagataaagac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47376943 |
aggtagacaatccatattcatcccaatgccagaaacatacagtcagtgtaa-gctataacaaattcaaattcaatcttgggtgaggatgcagataaagac |
47377041 |
T |
 |
| Q |
114 |
tcggtaaatgcatctactttattgtctttaatct------------aatttacgtttcttactttcttaaatgtcccaaatgggaatatgga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47377042 |
tcggtaaatgcatctactttattgtctttaatctaattctatgaacaatttacgtttcttactttcttaaatgtcccaaatgggaatatgga |
47377133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 194 - 229
Target Start/End: Original strand, 47377154 - 47377189
Alignment:
| Q |
194 |
aagtgtgatctctcaccattcatcaaaagatggaaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47377154 |
aagtgtgatctctcaccattcatcaaaagatggaaa |
47377189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University