View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_high_46 (Length: 244)
Name: NF21043_high_46
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_high_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 30781370 - 30781590
Alignment:
| Q |
19 |
tttacctttctgcaaccaccttgactctgagaggggatatcaaagtatgttatgaagagcaccagtgccttgcactaattgaaacggttattcagttata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781370 |
tttacctttctgcaaccaccttgactctgagaggggatatcaaagtatgttatgaagagcaccagtgccttgcactaattgaaacggttattcagttata |
30781469 |
T |
 |
| Q |
119 |
tgacaattagtcattagttagggtcttaactgtaatgacttctatctatagcaatgatgtaagaacaacttcagagtaatgaaatctttgcttcattttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30781470 |
tgacaattagtcattagttagggtcttaactgtaatgacttctatctacagcaatgatgtaag---aacttcagagtaatgaaatctttgcttcattttt |
30781566 |
T |
 |
| Q |
219 |
gtcttccagttaccctcttcctct |
242 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30781567 |
gtcttccagttaccctcttcctct |
30781590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University