View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_high_57 (Length: 224)
Name: NF21043_high_57
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_high_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 134 - 215
Target Start/End: Original strand, 42955609 - 42955690
Alignment:
| Q |
134 |
ctattacatactttgacaaactgcataatcgaaaattagcacgctttctatccttggaaagcaaattattttcttcattcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42955609 |
ctattacatactttgacaaactgcataatcgaaaattagcacgctttctatccttggaaagcaaattattttcttcattcat |
42955690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University