View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21043_high_58 (Length: 221)

Name: NF21043_high_58
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21043_high_58
NF21043_high_58
[»] chr4 (1 HSPs)
chr4 (3-221)||(1160087-1160305)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 1160305 - 1160087
Alignment:
3 gaggaggacatggaggttcaggtggccatggaagtggaatgggaggaagaggaattggtagaggaaggtcaggtggagcagctgcaggaattatcggcgg 102  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1160305 gaggaggacatggaggttcaggtggccatggaagtggaatgggaggaagaggaattggtagaggaaggtcaggtggagcagctgcaggaattatcggcgg 1160206  T
103 tgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaattatgaacacaaacaccttcatgtttgtgtcccaaaa 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |    
1160205 tgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaattatggacacaaacaccttcatgtttgtgtcccaaca 1160106  T
203 tttattttatgtttgagtt 221  Q
    |||||||||||||||||||    
1160105 tttattttatgtttgagtt 1160087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University