View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_15 (Length: 464)
Name: NF21043_low_15
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 50550440 - 50550576
Alignment:
| Q |
18 |
ttttcaatcttagcagtggatgatacgaactccgggctccatttagcaacagcaaggtagtgatcaaagatcatccacggaccctctccaatgactttat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
50550440 |
ttttcaatcttagcagtggatgatacgaactccaggctccatttagcaacagtaaggtaatgatcaaagatcatccacagaccctctccaatgactttat |
50550539 |
T |
|
| Q |
118 |
ctctatcttcagccatgtcaaacttcatcatataaaa |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50550540 |
ctctatcttcagccatgtcaaacttcatcgtataaaa |
50550576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University