View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21043_low_3 (Length: 833)

Name: NF21043_low_3
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21043_low_3
NF21043_low_3
[»] chr7 (2 HSPs)
chr7 (1-48)||(10868013-10868060)
chr7 (1-48)||(10866296-10866343)
[»] chr4 (5 HSPs)
chr4 (1-53)||(15039952-15040004)
chr4 (1-53)||(15041681-15041733)
chr4 (1-53)||(15112691-15112743)
chr4 (1-53)||(15114420-15114472)
chr4 (1-53)||(16003524-16003576)
[»] chr3 (2 HSPs)
chr3 (4-48)||(8584451-8584495)
chr3 (1-53)||(34143008-34143060)
[»] chr8 (1 HSPs)
chr8 (1-39)||(30187799-30187837)
[»] chr6 (1 HSPs)
chr6 (1-38)||(34244769-34244806)


Alignment Details
Target: chr7 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10868060 - 10868013
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaact 48  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||    
T  10868060 tgaatgagtacatggttggtccttttatagacctcaattaccctaact 10868013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 10866343 - 10866296
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaact 48  Q
    ||||||||||||||||||||||||||||| | |||||||| |||||||    
T  10866343 tgaatgagtacatggttggtccttttataaatctcaattaccctaact 10866296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 15039952 - 15040004
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaactgcttg 53  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||| ||||    
T  15039952 tgaatgagtacatggttggtccttttatagacctcaatgaccctaactacttg 15040004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 15041681 - 15041733
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaactgcttg 53  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||| ||||    
T  15041681 tgaatgagtacatggttggtccttttatagacctcaatgaccctaactacttg 15041733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 15112743 - 15112691
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaactgcttg 53  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||| ||||    
T  15112743 tgaatgagtacatggttggtccttttatagacctcaatgaccctaactacttg 15112691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 15114472 - 15114420
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaactgcttg 53  Q
    |||||||||||||||||||||||||||||||||||||| | ||||||| ||||    
T  15114472 tgaatgagtacatggttggtccttttatagacctcaatgaccctaactacttg 15114420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 16003576 - 16003524
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaactgcttg 53  Q
    |||||||||| ||||||||||||||||||||||||||||| ||||||| ||||    
T  16003576 tgaatgagtatatggttggtccttttatagacctcaattaccctaactacttg 16003524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000008; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 4 - 48
Target Start/End: Complemental strand, 8584495 - 8584451
Alignment:
Q  4 atgagtacatggttggtccttttatagacctcaattatcctaact 48  Q
    |||||||||||||||||||||||||||||||||||| ||||||||    
T  8584495 atgagtacatggttggtccttttatagacctcaattttcctaact 8584451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 34143060 - 34143008
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaattatcctaactgcttg 53  Q
    ||||||||||||||||||||||||||||||| |||||||| ||||||| ||||    
T  34143060 tgaatgagtacatggttggtccttttatagaactcaattaccctaactacttg 34143008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 30187799 - 30187837
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaatt 39  Q
    |||||||||||||| ||||||||||||||||||||||||    
T  30187799 tgaatgagtacatgattggtccttttatagacctcaatt 30187837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 34244806 - 34244769
Alignment:
Q  1 tgaatgagtacatggttggtccttttatagacctcaat 38  Q
    |||||||||| |||||||||||||||||||||||||||    
T  34244806 tgaatgagtatatggttggtccttttatagacctcaat 34244769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University