View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_43 (Length: 259)
Name: NF21043_low_43
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 46062147 - 46062400
Alignment:
| Q |
1 |
ctggaaaagacaatcttcttctcatcgtcgttggcactcacaaactccttcaccaagccatctagagatggtactataccagcctaaaacatgaataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062147 |
ctggaaaagacaatcttcttctcatcgtcgttggcactcacaaactccttcaccaagccatctagagatggtactataccagcctaaaacatgaataatt |
46062246 |
T |
 |
| Q |
101 |
ggttcactcagctatcaagattcaagtatattattctagtctcttatgatgctaaacatatattttaaactaactttagaagtaagttgaccctgttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062247 |
ggttcactcagctatcaagattcaagtatattattctagtctcttatgatgctaaacatatattttaaactaactttagaagtaagttgaccctgttcat |
46062346 |
T |
 |
| Q |
201 |
cacggttagtgccacatctcgcattaatgaaaaatacaaaatcgttcatctcac |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
46062347 |
cacggttagtgccacatctcgcattaatgaaaaatacaaaatcgtccatatcac |
46062400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University