View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_55 (Length: 238)
Name: NF21043_low_55
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_55 |
 | |
|
| [»] scaffold0088 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0088 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 7 - 120
Target Start/End: Original strand, 47750 - 47863
Alignment:
| Q |
7 |
atttcttcatcctcgcattaggaaggccatttggcatggtagcacaaactcaaaaactgataaaggtatactcatatgatgttgtctaatttcgtggtgt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47750 |
atttcttcatcctcgcattaggaaggccatttggcatggtagcacagactcaataactgataaaggtatactcatatgatgttgtctaatttcgtggtgt |
47849 |
T |
|
| Q |
107 |
ttttacacccattt |
120 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47850 |
ttttacacccattt |
47863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University