View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_56 (Length: 237)
Name: NF21043_low_56
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_56 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4756560 - 4756338
Alignment:
| Q |
1 |
aagtaacattaatcacttttgtgagtagtactaaagatgttttgactcctctacagccgcatacggtgcaatactttcagaattgttgaaattagttaaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4756560 |
aagtaacattaataacttttgtgagtagtactaaagatgttttgactcctctacagccacatacggtgcaatactttcagaatcgttgaaattagttaaa |
4756461 |
T |
 |
| Q |
101 |
ctgaaagtcaaaagtttaacagtttaaataattcaacgattctctagtaactgtaccgtacaaatgccgcagagaattcaaattcacactatgagc--aa |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
4756460 |
ctgaaagtcaaaagtttaactctttaaataattcaacgattctctagtaactgtaccgtacaaatgcggcagagaattcaaattcacactatgagcaaaa |
4756361 |
T |
 |
| Q |
199 |
tagatagaagagtacctagaaac |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4756360 |
tagatagaagagtacctagaaac |
4756338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University