View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_61 (Length: 228)
Name: NF21043_low_61
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 23 - 212
Target Start/End: Complemental strand, 43456075 - 43455886
Alignment:
| Q |
23 |
ggagcaaaagatgtatatttctccactcagttttctcagtcaacttttggacaatttaaatcatgtctatggaagcaatggttgacttattggaggagtc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43456075 |
ggagcaaaagatgtatatttctccactcagttttctcagtcaacttttggacaatttaaatcatgtctatggaagcaatggttgacttattggaggagtc |
43455976 |
T |
 |
| Q |
123 |
cagattacaaccttgtcagatatttcttcaccttgacagcagctctcatggtagggacagtgttttggaaagccggcgagaaaaggttta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43455975 |
cagattacaaccttgtcagatatttcttcaccttgacagcagctctcatggtagggacagtgttttggaaagccggcgagaaaaggttta |
43455886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 56 - 194
Target Start/End: Original strand, 4502660 - 4502798
Alignment:
| Q |
56 |
tctcagtcaacttttggacaatttaaatcatgtctatggaagcaatggttgacttattggaggagtccagattacaaccttgtcagatatttcttcacct |
155 |
Q |
| |
|
||||| ||||| ||||||||||| | ||| ||||| |||||||| |||||||| ||||||||||||||||||||||| || ||||||||||| ||| ||| |
|
|
| T |
4502660 |
tctcaatcaacatttggacaattcacatcttgtctttggaagcagtggttgacatattggaggagtccagattacaatctagtcagatattttttctcct |
4502759 |
T |
 |
| Q |
156 |
tgacagcagctctcatggtagggacagtgttttggaaag |
194 |
Q |
| |
|
|| | ||||||||| |||||||||| |||||||||| |
|
|
| T |
4502760 |
tggcttgtgctctcatgatagggacagtattttggaaag |
4502798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University