View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_64 (Length: 221)
Name: NF21043_low_64
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_64 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 1160305 - 1160087
Alignment:
| Q |
3 |
gaggaggacatggaggttcaggtggccatggaagtggaatgggaggaagaggaattggtagaggaaggtcaggtggagcagctgcaggaattatcggcgg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160305 |
gaggaggacatggaggttcaggtggccatggaagtggaatgggaggaagaggaattggtagaggaaggtcaggtggagcagctgcaggaattatcggcgg |
1160206 |
T |
 |
| Q |
103 |
tgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaattatgaacacaaacaccttcatgtttgtgtcccaaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
1160205 |
tgcagtggctggtggagttgctggtggagtggttggtggtgcagtcgccaatcacgggcacaattatggacacaaacaccttcatgtttgtgtcccaaca |
1160106 |
T |
 |
| Q |
203 |
tttattttatgtttgagtt |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1160105 |
tttattttatgtttgagtt |
1160087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University