View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21043_low_65 (Length: 217)
Name: NF21043_low_65
Description: NF21043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21043_low_65 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 2 - 198
Target Start/End: Complemental strand, 26856101 - 26855905
Alignment:
| Q |
2 |
atgcatcgccgattaatgcggtcgataatgcaagtcgtccgacatctgagtttataaggttaagctctttgagaatacaaaatagaacaggaaatgctgt |
101 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26856101 |
atgcatcgccgattaacgcggtcgataatgcaagtcgtccgacatctgagtttataaggttaagctctttgagaatacaaaatagaacaggaaatgctgt |
26856002 |
T |
 |
| Q |
102 |
tgttcctatggaccctgctaatattcccattgatgaaattgtggccaattctttgtccatggattttcttaaacatagtgccaacacaaatactaat |
198 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26856001 |
tgttcctatgtaccctgctaatactcccattgatgaaattgtggctaattctttgtccatggattttcttaaacatagtgccaatacaaatactaat |
26855905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University