View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21044_high_7 (Length: 250)
Name: NF21044_high_7
Description: NF21044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21044_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 51068061 - 51068309
Alignment:
| Q |
1 |
ttaaatatcttaaaatttaattggatactaatacttttaaacaannnnnnnnnaat-tttaaattattttaaaatgaattacataaaaacataacatggt |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| || ||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51068061 |
ttaaatatcttaaattttaattggatactaatacttttaaacaatttttttaaaaaatttgaattattttaaaataaattacataaaaacataacatggt |
51068160 |
T |
|
| Q |
100 |
ataaaatgatcggatgaaatgcacatgctcaatcaatacttcttagtaatttgctttc---------ttttaattgtcaaatttgaagaaattgtttatt |
190 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
51068161 |
ataaaatgattggatgaaaggcacatgctcaatcaatacttcttagtaatttgctttctatgttcttttttaattgtcaaatttaaagaaattgtttatt |
51068260 |
T |
|
| Q |
191 |
catatttaactatcttttcaaagttggtattaaatttttattcaccttt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51068261 |
catatttaactatcttttcaaagttggtattaattttttattcaccttt |
51068309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University