View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21044_low_1 (Length: 441)
Name: NF21044_low_1
Description: NF21044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21044_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 28 - 396
Target Start/End: Complemental strand, 13770902 - 13770512
Alignment:
| Q |
28 |
taactgtaacttgcatctcccctttaccctctacaaagcataaagtggtaagaaaaatgagaaatatgcaaaatggaac--------------atagaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13770902 |
taactgtaacttgcatctcccctttaccctctacaaagcataaagtggtaagaaaaatgagaaaaatgcaaaatggaaccctgaacaaagaacatagaac |
13770803 |
T |
|
| Q |
114 |
tgaagaagatatttctagtacccgatctttattactgttgaggttcctgcaaagtcccaggccatgagacaattgcagggaaccaggaagagccattata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770802 |
tgaagaagatatttctagtacccgatctttattactgttgaggttcctgcaaagtcccaggccatgagacaattgcagggaaccaggaagagccattata |
13770703 |
T |
|
| Q |
214 |
gtatcaaattatatagccttgcagaccgaccgacgtctatactctaaagagatagagatgtattgatgcagaaacaatgttttaactcagtttcctgcag |
313 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13770702 |
gtatcaaattatatagccttgca----gacggacgtctatactctaaagagatagagatgtattgatgcagaaacaatgttttaactcagtttcctgcag |
13770607 |
T |
|
| Q |
314 |
ttaaactcatattaatcaactaaagcatcataaaagttaaggatttaa------------ataattagaaaagttaagcatcacaagttcacaac |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
13770606 |
ttaaactcatattaatcaactaaagcatcataaaagttaaggatttaaaacatgtacattataattagaaaatttaagcatcacaagttcacaac |
13770512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University