View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21044_low_10 (Length: 231)
Name: NF21044_low_10
Description: NF21044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21044_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 27736345 - 27736145
Alignment:
| Q |
18 |
attcactgtatgatgaagcatgtctccttctaaactattttgatagtactgtgaatcaatggaagttgtatttgctttttggtgagagatatgagaacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27736345 |
attcactgtatgatgaagcatgtctccttctaaactattttgatagtactgtgaatcaatggaagttgtatttgctttttggtgagagatatgagaacaa |
27736246 |
T |
|
| Q |
118 |
acttcaaatcaagttgccacatccttttgacggaaaccgtggctattatcagaccgtaagtattttaagttccggtattaatggcactctttgcatctgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27736245 |
acttcaaatcaagttgccacatccttttgacggaaaccgtggctattatcagaccgtaagtattttaagttccggtattaatggcactctttgcatctgt |
27736146 |
T |
|
| Q |
218 |
g |
218 |
Q |
| |
|
| |
|
|
| T |
27736145 |
g |
27736145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 27725097 - 27724906
Alignment:
| Q |
18 |
attcactgtatgatgaagcatgtctccttctaaactattttgatagtactgtgaatcaatggaagttgtatttgctttttggtgagagatatgagaacaa |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
27725097 |
attcactgtatcatgaagcatgtctccttctaaactattttgagagtactgagaatcaatggaagttgtatttgctttccggtgagagatatgagagtaa |
27724998 |
T |
|
| Q |
118 |
acttcaaatcaagttgccacatccttttgacggaaaccgtggctattatcagaccgtaagtattttaagttccggtattaatggcactctttgcatct |
215 |
Q |
| |
|
| ||||||| |||| ||| |||||||||||| ||||| ||||||||||| | | ||||||| |||| |||||||||| ||||||||| |||| |
|
|
| T |
27724997 |
agttcaaatgaagtggcctcatccttttgacagaaactatggctattatccg------aatattttaggttctggtattaatgacactctttgtatct |
27724906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 75 - 215
Target Start/End: Complemental strand, 14682689 - 14682555
Alignment:
| Q |
75 |
aatggaagttgtatttgctttttggtgagagatatgagaacaaacttcaaatcaagttgccacatccttttgacggaaaccgtggctattatcagaccgt |
174 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||| ||||||| |||| |||||||||||||||| ||| ||||||| |||| |||| |
|
|
| T |
14682689 |
aatggaagttgtattttctttctggtgagagatttgagaacaaagttcaaatgaagtggccacatccttttgaccaaaaacgtggctgttat----ccgt |
14682594 |
T |
|
| Q |
175 |
aagtattttaagttccggtattaatggcactctttgcatct |
215 |
Q |
| |
|
|||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
14682593 |
--gtattttaggttcaagtattaatggtactctttgcatct |
14682555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University