View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21045_high_40 (Length: 226)
Name: NF21045_high_40
Description: NF21045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21045_high_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 28342176 - 28342372
Alignment:
| Q |
16 |
cctttttcccttgtcttgacccttttgaaaccctcttcacagccacttctaatttgttgnnnnnnncaagtaaacctttgtaaacacctccaaatccacc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28342176 |
cctttttcccttgtcttgacccttttgaaaccctcttcacagccacttctaatttgttgtttttttcaagtaaacctttgtaaacacctccaaatccacc |
28342275 |
T |
|
| Q |
116 |
ttctccaagctttcctctttcatcgaaaccatttgttgaattgcttagttctttgtaagtgaacctttttggaccagttcctctctcgaattcatct |
212 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28342276 |
ttctccaagctttcctttttcatcgaaaccatttgttgaattgcttagttctttgtaagtgaacctttttggaccagttcctctctcgaattcatct |
28342372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University