View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21045_low_31 (Length: 309)
Name: NF21045_low_31
Description: NF21045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21045_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 101 - 291
Target Start/End: Complemental strand, 56158847 - 56158646
Alignment:
| Q |
101 |
acttcctttctttgattttgattttctgttcataattaaaagaaattaatgtttgatttctttattactctaaataaata-----gtacctacata---- |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||| |||| |||||| |
|
|
| T |
56158847 |
acttcctttctttgattttgattttctgttcataa----aagaaattaatgtttgatttctt-actactctaaataaataaaatagtacatacatatata |
56158753 |
T |
|
| Q |
192 |
----cct---tagatgtgatttgtttgctccaatgattaaattgttgatttgaagaattggaataaggtcgaggatggcctttgcaacaaagtcactctc |
284 |
Q |
| |
|
||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56158752 |
catacctaattagatgggatttgtttgctccaatgattaaattgttgatttgaagaattggaataaggtcgaggatggcctttgcaacaaagtcactctc |
56158653 |
T |
|
| Q |
285 |
tattagg |
291 |
Q |
| |
|
||||||| |
|
|
| T |
56158652 |
tattagg |
56158646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 56158883 - 56158978
Alignment:
| Q |
1 |
agaaagttgcaaggtcagaattatatgtgaagggaaggaagtaaatgagcaaatgatgttatcctcaccctctcctcagatatttactgctaccaa |
96 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56158883 |
agaaagttgcaaggttagaattatatgtgaagggaaggaagtaaatgagcaaatgatgttatcctcaccctctcctcagatatttactgctaccaa |
56158978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University