View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21045_low_36 (Length: 286)
Name: NF21045_low_36
Description: NF21045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21045_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 2483936 - 2484077
Alignment:
| Q |
18 |
ctttattcactagtctagtatgaatgcaagataata-----tgtatatatggctcgtagtacatgtgagttgcatctccacttaggataataagagtttt |
112 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2483936 |
ctttattcactagtctatcatgaatacaagataatagttaatgtatatatggctcatagtacatgtgagttgcatctccacttaggataataagagtttc |
2484035 |
T |
|
| Q |
113 |
gttgggtttaatcatcgaacgagacccacaagataggaatac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2484036 |
gttgggtttaatcatcgaacgagacccacaagataggaatac |
2484077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 154
Target Start/End: Complemental strand, 7439027 - 7438889
Alignment:
| Q |
18 |
ctttattcactagtctagtatgaatgcaagataat--atgtatatatggctcgtagtacatgtgagttgcatctccacttaggataataagagttttgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| || | ||||||||||||||| ||| |||||||||||||||||| ||||||||||||| ||||||| || |
|
|
| T |
7439027 |
ctttattcactagtctagtatgaatgcaaggtagtttatgtatatatggctcataggacatgtgagttgcatctctacttaggataataggagttttatt |
7438928 |
T |
|
| Q |
116 |
gggtttaatcatcgaacgagacccacaagataggaatac |
154 |
Q |
| |
|
||||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
7438927 |
gggtttaattattgaatgagacccacaagataggaatac |
7438889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 154
Target Start/End: Complemental strand, 7340304 - 7340176
Alignment:
| Q |
18 |
ctttattcactagtctagtatgaatgcaagataata-----tgtatatatggctcgtagtacatgtgagttgcatctccacttaggataataagagtttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7340304 |
ctttattcactagtctagtatgaatgcaagataatagttaatgtatatatggctcgtag-------------catctccacttaggataataagagtttt |
7340218 |
T |
|
| Q |
113 |
gttgggtttaatcatcgaacgagacccacaagataggaatac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340217 |
gttgggtttaatcatcgaacgagacccacaagataggaatac |
7340176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 230 - 273
Target Start/End: Complemental strand, 7340100 - 7340057
Alignment:
| Q |
230 |
gcaatgctagtttagtattgctagatgatttgactctcttgcct |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340100 |
gcaatgctagtttagtattgctagatgatttgactctcttgcct |
7340057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 230 - 273
Target Start/End: Original strand, 2484155 - 2484198
Alignment:
| Q |
230 |
gcaatgctagtttagtattgctagatgatttgactctcttgcct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2484155 |
gcaatgctagtttagtattgctagatgatttgactgtcttgcct |
2484198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 55 - 124
Target Start/End: Original strand, 2632072 - 2632139
Alignment:
| Q |
55 |
gtatatatggctcgtagtacatgtgagttgcatctccacttaggataataagagttttgttgggtttaat |
124 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||| |||| ||| |||||| ||| |||||||| |
|
|
| T |
2632072 |
gtatatatggctcatagtacaagtgagttgcatctccactcaggacaat--gagtttggtttggtttaat |
2632139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University