View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21045_low_38 (Length: 269)
Name: NF21045_low_38
Description: NF21045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21045_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 56158907 - 56158646
Alignment:
| Q |
1 |
tataattctgaccttgcaactttctggtgcactctttagtatttgatcgcccacaccgccacttcctttctttgattttgattttctgttcataattaaa |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
56158907 |
tataattctaaccttgcaactttctggtgcactctttagtacttgatcgcccacaccgccacttcctttctttgattttgattttctgttca----taaa |
56158812 |
T |
 |
| Q |
101 |
agaaattaatgtttgatttctttattactctaaat-----aaatagtac--------ctacatacc---ttagatgtgatttgtttgctccaatgattaa |
184 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||| |||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
56158811 |
agaaattaatgtttgatttc-ttactactctaaataaataaaatagtacatacatatatacatacctaattagatgggatttgtttgctccaatgattaa |
56158713 |
T |
 |
| Q |
185 |
attgttgatttgaagaattggaataaggtcgaggatggcctttgcaacaaagtcactctctattagg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56158712 |
attgttgatttgaagaattggaataaggtcgaggatggcctttgcaacaaagtcactctctattagg |
56158646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University