View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21045_low_39 (Length: 263)
Name: NF21045_low_39
Description: NF21045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21045_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 245
Target Start/End: Complemental strand, 27656427 - 27656195
Alignment:
| Q |
13 |
aatatcatcaactgtaaatatttttagatcgtcaattaatatcgattgtcagataattaaaaatattttattatcattacgactatttctaaagttacac |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| |
|
|
| T |
27656427 |
aatatcatcaactgtaaatattgttagatcgtcaattaatatcgattgtcagataattaaaaatattttattttcattatgactacttctaaagttacac |
27656328 |
T |
 |
| Q |
113 |
atgtgatttgttatgatttattgatagcgttaaaagtatcttagaaaagtatgtactaaccacgattgtgaggcccctaaatgcatcaagagttgcaacc |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27656327 |
atatgatttgttatgatttattgatagcgttaaaagcatcttagaaaagtatgtactaaccacgattgtgaggcccctaaatgcatcaagagttgcaacc |
27656228 |
T |
 |
| Q |
213 |
ctacnnnnnnngtgcttaacctcttgctccttt |
245 |
Q |
| |
|
|||| |||||||| ||||||||||||| |
|
|
| T |
27656227 |
ctactttttttgtgcttaatctcttgctccttt |
27656195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 213
Target Start/End: Original strand, 41310313 - 41310359
Alignment:
| Q |
167 |
actaaccacgattgtgaggcccctaaatgcatcaagagttgcaaccc |
213 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
41310313 |
actaaccacaatggtgaggcccctaaatgcatcaagtgttgcaaccc |
41310359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University