View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21045_low_40 (Length: 261)
Name: NF21045_low_40
Description: NF21045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21045_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 3 - 246
Target Start/End: Complemental strand, 37076678 - 37076435
Alignment:
| Q |
3 |
acttcaggctagtggtccagaagagactgcaaaaccaaaactcattggttttttcaaaggtcaagtctttacacttgaggatagactaactatgcatgct |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37076678 |
acttcaggctagtggtccagaagagactgcaaaaccaaaactcattggttttttcaaagatcaagtctttacacttgaggatagactaactatgcatgct |
37076579 |
T |
 |
| Q |
103 |
actgaagatttgttgttgttgtaagtttcttgatcatgtttggtggagctttgcattccaaaactcaaatggagaagaacacatattgtgtacatttagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37076578 |
actgaagatttgttgttgttgtaagtttcttgatcatgtttggtggagctttgcattccaaaactcaaatggagaagaacacatattgtgtacatttagt |
37076479 |
T |
 |
| Q |
203 |
ggtactgttgtgttttttcgggatgcttctaataccttcttctt |
246 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37076478 |
ggtactgttgtgtttcttcgggatgcttctaataccttcttctt |
37076435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University