View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21046_low_8 (Length: 260)
Name: NF21046_low_8
Description: NF21046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21046_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 44917937 - 44917702
Alignment:
| Q |
18 |
attgtgggtctaaattacattacattactttgttgtgggaatctttcctagatatacactaattgcattcaaattggatttgatatttactccttctttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44917937 |
attgtgggtctaaattacattacattactttgttgtgggaatctttcctagatatacactaattgcattcaaattggattggatatttactccttctttc |
44917838 |
T |
 |
| Q |
118 |
atgtagtacttttggcatgaacttacaacatgcaataattggtacatgctgatagtgactaagaaattgtccctatagtatagactttaattattataat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44917837 |
atgtagtacttttggcatgaacttacaacatgcaataattggtacatgctgatagtgactaagaaattgtccctatagtatagactttaattattataat |
44917738 |
T |
 |
| Q |
218 |
gttttttacttgaatttggtgttctagttcatctca |
253 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44917737 |
gttttttactttaatttggtgttctagttcatctca |
44917702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University