View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21046_low_9 (Length: 246)
Name: NF21046_low_9
Description: NF21046
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21046_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 83 - 231
Target Start/End: Original strand, 36209646 - 36209802
Alignment:
| Q |
83 |
aatttgaagttcaaaacaacgaattaattgaatgagtacaaatatgatttttaaatttaatcttacgaaaagggactatcttggtcaatatttttgaaga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| | |
|
|
| T |
36209646 |
aatttgaagttcaaaacaacgaattaatcgaatgagcacatgtatgatttttaaatttaatcttacgaaaagggactatctaggtcaatattcttgaaca |
36209745 |
T |
|
| Q |
183 |
aaattgg--------catgagcacaacactagaatacttacccaatcaagaagatgg |
231 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36209746 |
caattggcatgaagccatgaacacaacactagaatacttacccaatcaagaagatgg |
36209802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 36209538 - 36209611
Alignment:
| Q |
1 |
ttgttgaaatttgaacccaatcttttatcaactagctctatttcattgcctttctctttcaagatatgtgcctg |
74 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36209538 |
ttgttgaaatttgaacccaatcttttatctactagctctatttcatttcctttctctttcaagatatgtgcctg |
36209611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University