View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21047_high_10 (Length: 254)
Name: NF21047_high_10
Description: NF21047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21047_high_10 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 11 - 236
Target Start/End: Complemental strand, 2989855 - 2989630
Alignment:
| Q |
11 |
cagagagaatggagtaacctgtgatgtttgcaaatccaatggcaagtgacccacctgctaaagcaagttcaccaacacgaccaaggaacaacattgaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989855 |
cagagagaatggagtaacctgtgatgtttgcaaatccaatggcaagtgacccacctgctaaagcaagttcaccaacacgaccaaggaacaacattgaaat |
2989756 |
T |
 |
| Q |
111 |
gatggaacgagaataaagtaataaacctgttaaaaccataggtaatgctatgtttgaaatatgtttggcttcattgagggcaagagaaaaatgggttttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2989755 |
gatggaacgagaataaagtaataaacctgttaaaaccataggtaatgctatgtttgaaatatgtttggcttcattgagggcaagagaaaaatgggttttc |
2989656 |
T |
 |
| Q |
211 |
ttttgttgtttgaatgttggggattt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2989655 |
ttttgttgtttgaatgttggggattt |
2989630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 70
Target Start/End: Complemental strand, 23719 - 23660
Alignment:
| Q |
11 |
cagagagaatggagtaacctgtgatgtttgcaaatccaatggcaagtgacccacctgcta |
70 |
Q |
| |
|
|||| |||||||||||||| |||||||| ||||| ||||| ||||| |||||||| |||| |
|
|
| T |
23719 |
cagaaagaatggagtaaccagtgatgttggcaaaaccaatagcaagggacccaccagcta |
23660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University