View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21047_high_12 (Length: 234)
Name: NF21047_high_12
Description: NF21047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21047_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 57 - 216
Target Start/End: Original strand, 22513309 - 22513468
Alignment:
| Q |
57 |
tggcagcagctccacgacaacaaatatcaggtggcttaggcgggagtggaggttgtgtcaatagattttctatcttttgatcttcacttacttgtaaagt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
22513309 |
tggcagcagctccacgacaacaaatatcaggtggcttaggcgggagtggaggttgtgtcgatagattttctatcttttgatcttcagttacttgtaaagt |
22513408 |
T |
 |
| Q |
157 |
attggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgttcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22513409 |
attggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgttcac |
22513468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 120 - 212
Target Start/End: Complemental strand, 42313865 - 42313773
Alignment:
| Q |
120 |
gattttctatcttttgatcttcacttacttgtaaagtattggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42313865 |
gattttctatcttttgatcttcacttatatgtaaagtattggcagtatgcttctggcattctttatttttagatggtaaaactaaagacttgt |
42313773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 121 - 182
Target Start/End: Complemental strand, 42309897 - 42309836
Alignment:
| Q |
121 |
attttctatcttttgatcttcacttacttgtaaagtattggcagtatgcttctggcattctt |
182 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| |||||||||| |||||| |
|
|
| T |
42309897 |
attttctatcttttgatcttcattaacttgtaaagtattggcaacatgcttctggtattctt |
42309836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 15 - 113
Target Start/End: Original strand, 13883974 - 13884072
Alignment:
| Q |
15 |
gaatatgaaatgaatgataaaatgacgaggaacaaaaactcatggcagcagctccacgacaacaaatatcaggtggcttaggcgggagtggaggttgtg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||| ||| |||||||||||| |
|
|
| T |
13883974 |
gaatatgaaatgaatgataaaatgacgaggaacaaaaactcatggcagcaactccacgacaacataaatcaggtggcttaggagggggtggaggttgtg |
13884072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University