View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21047_low_14 (Length: 205)

Name: NF21047_low_14
Description: NF21047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21047_low_14
NF21047_low_14
[»] chr4 (1 HSPs)
chr4 (18-189)||(46226892-46227063)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 46226892 - 46227063
Alignment:
18 aaaattgtaggcaagaaattattagagggaagaatgcatgtgttttctttgagtagaatgnnnnnnnnncgttggttcaacttagaccttttaactaaaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||    
46226892 aaaattgtaggcaagaaattattagagggaagaatgcatgtgttttctttgagtagaatgtttttttttcgttggttcaacttagaccttttaactaaaa 46226991  T
118 catggtcttacacttcattggtacttgtaaatgtgattttaatctatctttctttttatctcttcttctata 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46226992 catggtcttacacttcattggtacttgtaaatgtgattttaatctatctttctttttatctcttcttctata 46227063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University