View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21048_low_11 (Length: 259)
Name: NF21048_low_11
Description: NF21048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21048_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 229
Target Start/End: Original strand, 45386843 - 45387060
Alignment:
| Q |
16 |
acaaacaacattgtcctttccttcgatcctttccttctcattgtggttgcttcacaatcgtaaaacctttccaatgggtcactccaacgcaaataaactt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45386843 |
acaaacaacattgtcctttccttcgatcctttccttctcattgtggttgcttcacaatcgtaaaacctttccaatgggtcactccaacgcaaacaaactt |
45386942 |
T |
 |
| Q |
116 |
ctctata-nnnnnnnngctcttacgttaataacactattaattgttattggcgccttatgcctcttacctgttctaacattgaggaa---tattgaggtt |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45386943 |
ctctatatttttttttgctcttacgttaataacactattaattgttattggcgccttatgcctcttacctgttctaacattgaggaatattattgaggtt |
45387042 |
T |
 |
| Q |
212 |
ggtttttatgttttcttg |
229 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45387043 |
ggtttttatgttttcttg |
45387060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University