View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21048_low_9 (Length: 329)
Name: NF21048_low_9
Description: NF21048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21048_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 9 - 311
Target Start/End: Complemental strand, 4570821 - 4570518
Alignment:
| Q |
9 |
gacatcatcagtttatgaggataaattaaaggtaataaccttcatttttgtgattatcgcacccccgaacttgaactttgctcttccttgagtgatgtaa |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570821 |
gacatcattagtttatgaggataaattaaaggtaataaccttcatttttgtgattatcgcacccccgaacttgaactttgctcttccttgagtgatgtaa |
4570722 |
T |
|
| Q |
109 |
ctaagggtattgatcatttagttccnnnnnnnn-ctaagcaaaagagaaaatacattaaatttgatcaatcaattcctagtttatgggattacacataaa |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570721 |
ctaagggtattgatcatttagttcctttttttttctaagcaaaagagaaaatacattaaatttgatcaatcaattcctagtttatgggattacacataaa |
4570622 |
T |
|
| Q |
208 |
ttgtgcatttaataagttttgagcaggattgtcctcatgtatggattccacaacaaacatctaaatcaccccctttaacacaacttagattgttcaccca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570621 |
ttgtgcatttaataagttttgagcaggattgtcctcatgtatggattccacaacaaacatctaaatcaccccctttaacacaacttagattgttcaccca |
4570522 |
T |
|
| Q |
308 |
atat |
311 |
Q |
| |
|
|||| |
|
|
| T |
4570521 |
atat |
4570518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 49
Target Start/End: Complemental strand, 4570925 - 4570896
Alignment:
| Q |
20 |
tttatgaggataaattaaaggtaataacct |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4570925 |
tttatgaggataaattaaaggtaataacct |
4570896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University