View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2104R-Insertion-15 (Length: 246)
Name: NF2104R-Insertion-15
Description: NF2104R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2104R-Insertion-15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 50072926 - 50072688
Alignment:
| Q |
8 |
aaggtgatgatattgaactcagtaaagattatttggaagctggaatagagaggtttgaaggtttcacaaaggcagttgagggtttccttttggctaatcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50072926 |
aaggtgatgatattgaactcagtaaagattatttggaagctggaatagagagatttgaaggtttcacaaaggcagttgagagtttccttttggctaatcc |
50072827 |
T |
|
| Q |
108 |
tgattacaacaaagacagcaactaatccagacagtgttatgttattattatataatatgatccattgatccctttgtcttgctttatattccaataataa |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50072826 |
tgattacaacaaagacagcaactaattcagacagtgttatgttattattatataatatgatccattgatccctttgtcttgctttatattccaataataa |
50072727 |
T |
|
| Q |
208 |
aacatttcaatttgcatcgtgagaatattacatacggtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50072726 |
aacatttcaatttgcatcgtgagaatattacatacggtg |
50072688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University