View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2104R-Insertion-9 (Length: 412)
Name: NF2104R-Insertion-9
Description: NF2104R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2104R-Insertion-9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 9 - 309
Target Start/End: Complemental strand, 39918652 - 39918352
Alignment:
| Q |
9 |
tggtgtgagtttaaggattgttgttttggacgatgatgttttgagacggtgtttgaaaacggggttaacaaggattgacggtgtacggaactttgagtaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918652 |
tggtgtgagtttaaggattgttgttttggacgatgatgttttgagacggtgtttgaaaacggggttaacaaggattgacggtgtacggaactttgagtaa |
39918553 |
T |
|
| Q |
109 |
ccgcatttgtcggtgaaaagtttaactgatgcaacgttgtcgttttcagtagccatgtaagaatactcagcaccattttcacgaaaccattgttccattt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918552 |
ccgcatttgtcggtgaaaagtttaactgatgcaacgttatcgttttcagtagccatgtaagaatactcagcaccattttcacgaaaccattgttccattt |
39918453 |
T |
|
| Q |
209 |
tctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggctagttttgtgaaaacagggacatgattgga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918452 |
tctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcctaaaacgtaggctagttttgtgaaaacagggacatgattgga |
39918353 |
T |
|
| Q |
309 |
a |
309 |
Q |
| |
|
| |
|
|
| T |
39918352 |
a |
39918352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 358 - 412
Target Start/End: Complemental strand, 39918303 - 39918249
Alignment:
| Q |
358 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgccta |
412 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918303 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgccta |
39918249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 65 - 134
Target Start/End: Original strand, 5545448 - 5545517
Alignment:
| Q |
65 |
aaacggggttaacaaggattgacggtgtacggaactttgagtaaccgcatttgtcggtgaaaagtttaac |
134 |
Q |
| |
|
|||||||||| || || |||||||||||||||||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
5545448 |
aaacggggttgacgagaattgacggtgtacggaactttgtataaccgcatttttcagtgaagagtttaac |
5545517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University