View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2104_high_3 (Length: 385)
Name: NF2104_high_3
Description: NF2104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2104_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 55 - 271
Target Start/End: Original strand, 457061 - 457277
Alignment:
| Q |
55 |
taactaattaccatcgtggatttgttcagtggagtgaggacacagagctagttactaaggttatcatttatcaaggagatcgattgggtggattcggtct |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457061 |
taactaattaccatcgtggatttgttcagtggagtgaggacacagagcttgttactaaggttatcatttatcaaggagatcgattgggtggattcggtct |
457160 |
T |
|
| Q |
155 |
agagataggtaaataaaacaaaactgaactcatgaaaatagcttatgaccatgccataagccattttcacaacttctctatactagtatctcaaacgttt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
457161 |
agagataggtaaataaaacaaaactgaactcatgaaaatagcttatgaccatgccataagccattttcacaacgtctctatactagtatctcaaacgttt |
457260 |
T |
|
| Q |
255 |
atgttaatgcgaaagtt |
271 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
457261 |
atgttaatgcgaaagtt |
457277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 330 - 374
Target Start/End: Original strand, 457336 - 457380
Alignment:
| Q |
330 |
tgttaagaaagaaacacaatttgatttgatataaccttaccctat |
374 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
457336 |
tgttaaaaaagaaacacaatttgatttgatataaccttaccctat |
457380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University